View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13766_low_15 (Length: 225)
Name: NF13766_low_15
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13766_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 41759481 - 41759446
Alignment:
| Q |
1 |
acccttaatataatatagcgaatgttttgtagtatg |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41759481 |
acccttaatataatatagcgaatgttttgtagtatg |
41759446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University