View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13766_low_6 (Length: 324)
Name: NF13766_low_6
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13766_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 15 - 301
Target Start/End: Complemental strand, 34881300 - 34881013
Alignment:
| Q |
15 |
gagatgaatagg-atactaaagccagtcattcaaaggttgaaaactcaatatgtcttgcaggtcagtgttgactacctaacaaagcctcttgatattttc |
113 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881300 |
gagatgaatagggatactgaagccagtcattcaaaggttgaaaactcaatatgtcttgcaggtcagtgttgactacctaacaaagcctcttgatattttc |
34881201 |
T |
 |
| Q |
114 |
aaggagatgagtaggatactcaagccaggtggattggccataatgaggtgacaatcttgtcagctatcatttctgtaaaatctaataattgaaagaaaat |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881200 |
aaggagatgaataggatactcaagccaggtggattggccataatgaggtgacaatcttgtcagctatcatttctgtaaaatctaataattgaaagaaaat |
34881101 |
T |
 |
| Q |
214 |
tttcatgaagcactttcctacaaaattgtcacttgcttagatattcaatcatgttcatctattattggtcttgtacatcttatgctcc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881100 |
tttcatgaagcactttcctacaaaattgtcacttgcttagatattcaatcatgttcatctattattggtcttgtacatcttatgctcc |
34881013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University