View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13768_low_5 (Length: 237)
Name: NF13768_low_5
Description: NF13768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13768_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 21268199 - 21268397
Alignment:
| Q |
23 |
aattaattaatcctaaactaatacttaaaatgaaaatgtttgcgaaaaaaatctttctcttctgcagcatttgatagagctgaacagnnnnnnnnnnnnn |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268199 |
aattaattaatcctaaactaatacttaaaatgaaaatgtttgcgaaaaaaatctttctcttctgcagcatttgatagagctgaacagaaaaaagaaaaaa |
21268298 |
T |
 |
| Q |
123 |
nnnnntgcacataagtttcatccctggagaattacaagacttatgggatctatggggattagaaatactaatgctaatgagtttcacaatccaggttat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21268299 |
aaaaatgcacataagtttcatccctggagaattacaagacttatgggatctatggggcttagaaatactaatgctaatgagtttcacaatccaagttat |
21268397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University