View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13768_low_6 (Length: 230)
Name: NF13768_low_6
Description: NF13768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13768_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 74 - 221
Target Start/End: Original strand, 12804157 - 12804304
Alignment:
| Q |
74 |
agtatttgcatgtttctgggtgtggggtttggttacaccaccaatctatgttgttgctggaagatcttgatcttctttttgatgaagtggctattgagaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804157 |
agtatttgcatgtttctgggtgtggggtttggttacaccaccaatctatgttgttgttggaagatcttgatcttctttttgatgaagtggctattgagaa |
12804256 |
T |
 |
| Q |
174 |
aattgatgataacaataatagtgttaacaatatctttcccatgatgat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804257 |
aattgatgataacaataatagtgttaacaatatctttcccatgatgat |
12804304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University