View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13768_low_6 (Length: 230)

Name: NF13768_low_6
Description: NF13768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13768_low_6
NF13768_low_6
[»] chr4 (1 HSPs)
chr4 (74-221)||(12804157-12804304)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 74 - 221
Target Start/End: Original strand, 12804157 - 12804304
Alignment:
74 agtatttgcatgtttctgggtgtggggtttggttacaccaccaatctatgttgttgctggaagatcttgatcttctttttgatgaagtggctattgagaa 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
12804157 agtatttgcatgtttctgggtgtggggtttggttacaccaccaatctatgttgttgttggaagatcttgatcttctttttgatgaagtggctattgagaa 12804256  T
174 aattgatgataacaataatagtgttaacaatatctttcccatgatgat 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
12804257 aattgatgataacaataatagtgttaacaatatctttcccatgatgat 12804304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University