View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13769_high_3 (Length: 242)
Name: NF13769_high_3
Description: NF13769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13769_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 38506981 - 38506763
Alignment:
| Q |
7 |
tatgaatctaactcgaaggtaacattattcaaacccttattctttgctagcacccgactcaatacttaatatttaaagttgtgcgttgatgatatagatg |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38506981 |
tatgaatctaactcgaagataacattattcaaacccttattctttgctagcacccgactcaatacttaatatttaaagttgtgcgttgatgatatagatg |
38506882 |
T |
 |
| Q |
107 |
atttgtaacctagattgtttcttagttgagtcgttattttgtaaacaaaattaaattatgtcagcaaaatagatttaagtattgcatacatcattttatc |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38506881 |
atttgtaacctagattgttt-ttagttgagtcgttattttgtaaacaaaattaaattatgtcagcaaaatagatttaagtatttcatacatcattttatc |
38506783 |
T |
 |
| Q |
207 |
aagagataacaattttaata |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38506782 |
aagagataacaattttaata |
38506763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University