View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_116 (Length: 262)
Name: NF1376_high_116
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_116 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 11668 - 11518
Alignment:
| Q |
7 |
tagattattctatttaggatgagtcgattttaattgtaataagcatgaagtgtcactctagaattcagtagaattctgttatgccatgttctatatgcat |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11668 |
tagattcttctatttaggatgagtcgattttaattgtaataagcatgaaatgtcactctagaattcaggagaattctgttatgccatgttctatatgcat |
11569 |
T |
|
| Q |
107 |
tgtaaaataatctatgatgaaaagtatgaagttaacctagacgaatagcaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11568 |
tgtaaaataatctatgatgaaaagtatgaagttaccctagacgaatagcaa |
11518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University