View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_117 (Length: 262)
Name: NF1376_high_117
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_117 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 25777487 - 25777716
Alignment:
| Q |
1 |
ttaagtttagcgtgatgtgaacctttgggattctattgacaaggttcttcgtcaaaattacaatatagatgctctggttttcactctttaatttgcatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25777487 |
ttaagtttagcgtgatgtgaacctttgggattcaattgacaaggttcttcatcaaaattacaatatagatgctctggttttcactct----tttgcatca |
25777582 |
T |
|
| Q |
101 |
actttctccgggtcaaagtgaaccttttttcacggttttgtggagcttatg--aacacagaaacctgaaaatttgtcaacaaacagaacaaaacaagcac |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25777583 |
actttctccggttcaaagtgaaccttttttcacggttttgtggagtttatggaaacacagaaacctgaaaatttgtcaac-aacagaacaaaacaagcac |
25777681 |
T |
|
| Q |
199 |
gcaagtaattggatgagcaacccacttgcaggatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25777682 |
gcaagtaattggatgagcaacccacttgcaggatg |
25777716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University