View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_120 (Length: 255)
Name: NF1376_high_120
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_120 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 41918675 - 41918546
Alignment:
| Q |
1 |
attttatggtagagttttcttatcatctcccaatacctcctcttatgttcatcattctcttcatgtttgttttcaacaacgagtaaattccatactcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41918675 |
attttatggtagagttttcttatcatctcccaatacctcctcttatgttcatcattctcttcatgtttgttttcaacaacgagtaaattccatactcgta |
41918576 |
T |
|
| Q |
101 |
atgtctcttcgtcaagcattacttcaactt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41918575 |
atgtctcttcgtcaagcattacttcaactt |
41918546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 115
Target Start/End: Complemental strand, 1687540 - 1687440
Alignment:
| Q |
15 |
ttttcttatcatctcccaatacctcctcttatgttcatcattctcttcatgtttgttttcaacaacgagtaaattccatactcgtaatgtctcttcgtca |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
1687540 |
ttttcttatctcctcccaatacctcctcttatgttcatctttctcatcatgtttgttttcagcaacgagcaagttccatacacgtaatgtctcttcgtca |
1687441 |
T |
|
| Q |
115 |
a |
115 |
Q |
| |
|
| |
|
|
| T |
1687440 |
a |
1687440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University