View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_122 (Length: 252)
Name: NF1376_high_122
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_122 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 114 - 245
Target Start/End: Original strand, 14348357 - 14348488
Alignment:
| Q |
114 |
gacaaacgaatcctgtggtttttagaggaggagacttctagtaattcggtctggtggtaaataaaactttatcattaattgtattatccaagaattgaat |
213 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
14348357 |
gacaaacgaatcttgtgatttttagaggaggagacttctagtaattcggtctgatggtaaataaagctttatcattagttgtattattcaagaattgaat |
14348456 |
T |
|
| Q |
214 |
tcagattcccgtaaataattattcctatgata |
245 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
14348457 |
tcagattcccataaataattattcctatgata |
14348488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 38 - 94
Target Start/End: Original strand, 14348274 - 14348330
Alignment:
| Q |
38 |
ttgattttttgtgtgtaaccgtttgagcttaataaaaaattttagtgtgaatcctgt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
14348274 |
ttgattttttgtgtgtaaccgtttgagcttgataaaaaattttagcgtgaatcctgt |
14348330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 14347355 - 14347400
Alignment:
| Q |
1 |
ttagtagattattgtaattagtggttataaatatcatttgattttt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14347355 |
ttagtagattattgtaattagtggttataaatatcatttgactttt |
14347400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University