View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_135 (Length: 243)
Name: NF1376_high_135
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_135 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 39142123 - 39142344
Alignment:
| Q |
22 |
gctatatctatagactagacgttttggccatttcttcannnnnnnnccttgaccagagtccttcctttacactttcctctttcactttcatttctaggtt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142123 |
gctatatctatagactagacgttttggccatttcttcattttttttccttgaccagagtccttcctttacactttcctctttcactttcatttctaggtt |
39142222 |
T |
 |
| Q |
122 |
actctctctgtctctcannnnnnnngttacgtttcattttcatcacctgcttcaaaaagaccactaccatcatcttcatcatatatattgttaatggtaa |
221 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142223 |
actctctctgtctctcattttttttgttacgtttcattttcatcacctgcttcaaaaagaccactaccatcatcttcatcatatatattgttaatggtaa |
39142322 |
T |
 |
| Q |
222 |
atgtttctttggaaacatgaaa |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39142323 |
atgtttctttggaaacatgaaa |
39142344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University