View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_138 (Length: 237)
Name: NF1376_high_138
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_138 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 30355728 - 30355956
Alignment:
| Q |
1 |
ttctcgttcttagattctttgattttattcagatttgttgtaatttacaagttttaggtttggcgtcttgatggcttaatgtgatttatcaaggggtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355728 |
ttctcgttcttagattctttgattttattcagatttgttgtaatttacaagttttaggtttggcgtcttgatggcttaatgtgatttatcaaggggtttg |
30355827 |
T |
 |
| Q |
101 |
ttggtgtcatggtgcgtgaatcagtccatgttagcggccagttcattcctcgtagttcatatttgagatgtgaagagtaattgagagtgttatctatgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355828 |
ttggtgtcatggtgcgtgaatcagtccatgttagcggccagttcattcctcgtagttcata-ttgagatgtgaagagtaattgagagtgttatctatgac |
30355926 |
T |
 |
| Q |
201 |
ttgtcaatcaacttttatagagtattatct |
230 |
Q |
| |
|
| ||||||||||||||||||||| |||||| |
|
|
| T |
30355927 |
tcgtcaatcaacttttatagagtgttatct |
30355956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University