View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_139 (Length: 236)
Name: NF1376_high_139
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_139 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 32739791 - 32740005
Alignment:
| Q |
1 |
tctggcatttgtttctgttatacgcgctgtttcccaatcacgccacnnnnnnnttcagctgctactaaaatcg--------tttaccaaatgttccgagt |
92 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32739791 |
tctggcatttgtttatgttatacgcgctgtttcccaatcacgccacaaaaaaattcagctgctactaaaatctgaactggttttaccaaatgttccgagt |
32739890 |
T |
 |
| Q |
93 |
ctagctcgttcgttcacttccaaatgcactagacttgcttggcaaacagattgtgctgccagaaaaactgaaagcattttaaaaaacagttcatagaatc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32739891 |
ctagctcgttcgttcacttccaaatgcactagacttgcttggcaaacagattgtgctgccagaaaaattgaaagcattttaaaaaacagttcatagaatc |
32739990 |
T |
 |
| Q |
193 |
cctctgcctccatga |
207 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32739991 |
cctctgcctccatga |
32740005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 79 - 159
Target Start/End: Complemental strand, 9574888 - 9574808
Alignment:
| Q |
79 |
caaatgttccgagtctagctcgttcgttcacttccaaatgcactagacttgcttggcaaacagattgtgctgccagaaaaa |
159 |
Q |
| |
|
||||| |||| || ||||||||||| ||||||| ||| ||||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
9574888 |
caaattttcccagactagctcgttccttcacttgcaagtgcactagatttgcttggctaacagattgcgctgccagaaaaa |
9574808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University