View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_140 (Length: 232)
Name: NF1376_high_140
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_140 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 44461146 - 44461360
Alignment:
| Q |
1 |
cctgtactgtatttgagtctatggtatggtcctattagaaaaccatagaacacaatgagtatgaaatgtacctttcatagttgcatatcctgtggtttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44461146 |
cctgtactgtatttgagtctatggtatggt----------aaccatagaacacaatgagtatgaaatgtacctttcatacttgcatatcctgtggtttat |
44461235 |
T |
 |
| Q |
101 |
tcaagtgtgatgttgtaaaccattgatatttatttgctaaaatttagtatactgnnnnnnnagaagacggtgtatttcggctcgactaattgcatccatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44461236 |
tcaagtgtgatgttgtaaaccattgatatttatttgctaaaatttagtatactgtttttttagaagacggtgtatttcggctcgactaattgcatctatc |
44461335 |
T |
 |
| Q |
201 |
gttcgtctattccaatcctatgata |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44461336 |
gttcgtctattccaatcctatgata |
44461360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University