View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_143 (Length: 227)
Name: NF1376_high_143
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_143 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 32506664 - 32506532
Alignment:
| Q |
1 |
acattgcagatactccacttcaaatcttgcacttcttgatcaacaacactattggtactacttcctgattcatttatgttttgtctctctttttcacctc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506664 |
acattgcatatactccacttcaaatcttgcacttcttgatcaacaacactattggtactactacctgattcatttatgttttgtctctctttttcacctc |
32506565 |
T |
|
| Q |
101 |
tagattcatctgcttgtgtcgacctttgcttct |
133 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| |
|
|
| T |
32506564 |
tagattcatctgcttgtgtcgaccattgtttct |
32506532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University