View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_145 (Length: 220)
Name: NF1376_high_145
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_145 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 50400385 - 50400194
Alignment:
| Q |
1 |
cttcaggctctaccgaaaaatctggctcttcaggcttttgcaacttgggcatctctgcatccttgatcttctgaacccctttccttgtgtttgcagcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50400385 |
cttcaggctctaccgaaaaatctggctcttcaggcttttgcaacttgggcatctctgcatccttgatcttctgaacccctttccttgtgtttgcagcaaa |
50400286 |
T |
|
| Q |
101 |
tcttgaagccagtatagtgacacctagattctgttttacttgtgcggtgtttgaattcaccaaactgcggtgctcttcttcctcatgttcct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50400285 |
tcttgaagccagtatagtgacacctagattctgttttacttgtgcggtgtttgaattcaccaaactgcggtgctcttcttcctcgtgttcct |
50400194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University