View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_71 (Length: 346)
Name: NF1376_high_71
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_71 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 56 - 346
Target Start/End: Original strand, 50336965 - 50337255
Alignment:
| Q |
56 |
cgttacccaatcagaaatggatcctcaccgtcgaatttgcaacccgaaaccaccgcagagcttgatatgtttctggaacttcttcctttggagatgagga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336965 |
cgttacccaatcagaaatggatcctcaccgtcgaatttgcaacccgaaaccaccgcagagcttgatatgtttctggaacttcttcctttggagatgagga |
50337064 |
T |
 |
| Q |
156 |
tggaattgtatcgtcaccaagagattggtggactcattgaagttgttatggatttaggtagaaagcctcttgctagattcccttctggtgattgggtcat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337065 |
tggaattgtatcgtcaccaagagattggtggactcattgaagttgttatggatttaggtagaaagcctcttgctagattcccttctggtgattgggtcat |
50337164 |
T |
 |
| Q |
256 |
ttctcaacgacccattaaccatgatgatttacgccacgccatttctaaggtactactctacctctattttttggataaacaacttaattaa |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337165 |
ttctcaacgacccattaaccatgatgatttacgccacgccatttctaaggtaccactctacctctattttttggataaacaacttaattaa |
50337255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University