View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_76 (Length: 334)
Name: NF1376_high_76
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_76 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 29 - 326
Target Start/End: Complemental strand, 30831718 - 30831421
Alignment:
| Q |
29 |
agggagctaggaagttgcaccaaatatttagatattagaaagaatatttaccattagagatcatttccttaacaattgagtcaaaaaatttgtagatatt |
128 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30831718 |
agggacctaggaagttgcaccaaatatttagatattagaaagaatatttagcattagagatcatttccttaacagttgagtcaaaaaaattgtagatatt |
30831619 |
T |
|
| Q |
129 |
agaaagaatatttagcatatcaacaggaggagatccgaaccaatattataagcattccttatgatgcaaaatgaatgatttctcatccacgtagttcttc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831618 |
agaaagaatatttagcatatcaacaggaggagatccgaaccaatattataagcattccttatgatgcaaaatgaatgatttctcatccacgtagttcttc |
30831519 |
T |
|
| Q |
229 |
tgaccatgccaaaatgatgatggaatatggtgagaaattgggtctttactctttacctctaaggaatctaagtatgcataacttagcacattcatctc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30831518 |
tgaccatgccaaaatgatgatggaatatggtgagaaattgggtctttactctttacctctaaggaatctaagtatgcataacttagcacattcatctc |
30831421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University