View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_79 (Length: 333)
Name: NF1376_high_79
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 115 - 299
Target Start/End: Original strand, 45101376 - 45101559
Alignment:
| Q |
115 |
gtgatgcgatgactagtgttgtctcacccttaaaggtatataagaaaacgtgggaaggaaaggaaacaccgagagcgaacaataataatacgataatttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45101376 |
gtgatgcgatgactagtgttgtctcacccttaaaggtatataagaaaacgtgggaaggaaaggaaacaccgagagcgaacaataataatacgacaatttt |
45101475 |
T |
 |
| Q |
215 |
ttctcaccaaataaatccaannnnnnncttcatcgtcattttgtaacaatcaataactttgtttttgtcgagtataaaaattcac |
299 |
Q |
| |
|
||||||||||| |||||||| ||| || ||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45101476 |
ttctcaccaaacaaatccaattttttt-ttcttcatcattctgtaacaatcaataactttgtttttgtctagtataaaaattcac |
45101559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University