View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_83 (Length: 323)
Name: NF1376_high_83
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_83 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 123 - 323
Target Start/End: Original strand, 17687481 - 17687680
Alignment:
| Q |
123 |
gtttcattggatcttattttggggatagttgctgaatttgaaatttaactatattttggtctttttgttttgcaaatttctaatgttattatattattct |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17687481 |
gtttcattggatcttattttggggattgttgctgaatttgaaattgaactatatttttgtctttttgttttgcaaatttctaatgttattatattattct |
17687580 |
T |
|
| Q |
223 |
actattctaggctttgggatttatattttggtggtggatcttcaaactagatgtttcacgaatataaacaattgctggtatgagaaacaagcaaggctct |
322 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
17687581 |
actattctaggctttggggtttatattttggtggtggatcttcaaactggatgtttcacgaatataaacaattgccggtatgagaaacaa-caaggctct |
17687679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University