View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_87 (Length: 313)
Name: NF1376_high_87
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 63 - 302
Target Start/End: Complemental strand, 30772999 - 30772759
Alignment:
| Q |
63 |
gccaacatagaattacacactatctatcatggacatggtgtgaggctcattcattcagtcttagcaagtactctat-tttatgtaatgtaacaaatacat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
30772999 |
gccaacatagaattacacactatctatcatggacatggtgtgaggctcattcattcagtcttagcaagtgctctatctttatgtaatgtaacacatacat |
30772900 |
T |
|
| Q |
162 |
gcagtcgttttccaggagtgcaccattgttatgtacttttgtctttaactgcatgcatgccattctcagcagccaacgaagaatctctctcctgtcatgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
30772899 |
gcagtcgttttccaggagtgcaccattgttatgtacttttgtctttaactgcatgcatgccactctcagcagccaacgaagactctctctcatgtcatgt |
30772800 |
T |
|
| Q |
262 |
agttttcaagaacctcatcataaactacaacttgccttcat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30772799 |
agttttcaagaacctcatcataaactacaacttgccttcat |
30772759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University