View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1376_high_88 (Length: 312)

Name: NF1376_high_88
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1376_high_88
NF1376_high_88
[»] chr8 (1 HSPs)
chr8 (1-128)||(32506537-32506664)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 32506664 - 32506537
Alignment:
1 acattgcagatactccacttcaaatcttgcacttcttgatcaacaacactattggtactacttcctgattcatttatgttttgtctctctttttcacctc 100  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
32506664 acattgcatatactccacttcaaatcttgcacttcttgatcaacaacactattggtactactacctgattcatttatgttttgtctctctttttcacctc 32506565  T
101 tagattcatctgcttgtgtcgaccattg 128  Q
    ||||||||||||||||||||||||||||    
32506564 tagattcatctgcttgtgtcgaccattg 32506537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University