View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_89 (Length: 312)
Name: NF1376_high_89
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_89 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 30 - 306
Target Start/End: Complemental strand, 38556703 - 38556427
Alignment:
| Q |
30 |
gaggccgccaatgcttatgttgtctagacaatcagcccatggcatcaatggctgttgaacgctgcaactttcttttggctcgttatcctagttagaatga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556703 |
gaggccgccaatgcttatgttgtctagacaatcagcccatggcatcaatggctgttgaacgctgcaactttcttttggctcgttatcctagttagaatga |
38556604 |
T |
|
| Q |
130 |
aacaaacatgattacagacgaaacaagcatgattataaaacannnnnnnatgaaatgtactggatttgagttttttattataacatgggctacattttaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556603 |
aacaaacatgattacagacgaaacaagcatgattataaaacatttttttatgaaatgtactggatttgagttttttattataacatgggctacattttaa |
38556504 |
T |
|
| Q |
230 |
ctgatagaggagtggtactcagaattcagtttaaaattcaggaccgaccaccaactgatttctccaacctatgatac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38556503 |
ctgatagaggagtggtactcagaattcagtttaaaattcaggaccgaccaccaactgatttctccaacatgtgatac |
38556427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University