View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_high_93 (Length: 308)
Name: NF1376_high_93
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_high_93 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 126 - 279
Target Start/End: Original strand, 10086519 - 10086680
Alignment:
| Q |
126 |
gttttcaactttgtttctttcataaagtaacgattggtcattagggtcggtagtgaaaatcattttccataatcta--------tgaatatcaattgatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10086519 |
gttttcaactttgtttctttcataaagtaacgattggtcattagggtcggtagtgaaaatcattttccataatctatgcatcattgaatatcaattgatc |
10086618 |
T |
 |
| Q |
218 |
aaaatcaaaatgagtccaatacaaaaacaacatgatcatcttcaacttaacattaacattaa |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10086619 |
aaaatcaaaatgagtccaatacaaaaacaacatgatcatcttcaacttaacattaacattaa |
10086680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 10086465 - 10086533
Alignment:
| Q |
42 |
gtgcgtgtgtgagagagaaatagtgaggtatgtagagagactccatagaataaagttttcaactttgtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
10086465 |
gtgcgtgtgtgagagagaaatagtgaggtatgtagagagacaccgtagaataaagttttcaactttgtt |
10086533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University