View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_103 (Length: 318)
Name: NF1376_low_103
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_103 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 96 - 241
Target Start/End: Complemental strand, 29442907 - 29442761
Alignment:
| Q |
96 |
agaatgacaattaacttgttttaattcatgttgtctattaaatcatctgtgttcaattcacaactagactattgttagtttatgcagctggtcttgtttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442907 |
agaatgacaattaacttgttttaattcatgttgtctattaaattatatgtgttcaattcacaactagactattgttagtttatgcagctggtcttgtttc |
29442808 |
T |
|
| Q |
196 |
attggtgtaaccctcttttgttttaaatt-aattcaggttatctgtg |
241 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
29442807 |
attggttacaccctcttttgttttaaattaaattcaggttatgtgtg |
29442761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University