View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_108 (Length: 310)
Name: NF1376_low_108
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_108 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 42173041 - 42173286
Alignment:
| Q |
1 |
aatgcatgcattgtgttcagcttgagggaagccgtagacggttagaacttcttcttgaggatgttgcatgtgactatgatcctttggattattatgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42173041 |
aatgcatgcattgtgttcagcttgagagaagccgtagacggttagaacttcttcttgaggatgttgcatgtgactatgatcctttggattattatgaaac |
42173140 |
T |
|
| Q |
101 |
agctgagcagcttttggatcctctgctcctctgttatgaatctctggtactctttccttccctctctttcctgaaaggtttgttcacactccacaattgc |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42173141 |
agctgaccagcttttggatcctctgctcctcagttatgaatctctggtactctttccttccctttctttcctgaaaggtttgttcacactccacaattgc |
42173240 |
T |
|
| Q |
201 |
tatttaactctccatgtcttcagcaatcatgtgggtctgtggtgct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42173241 |
tatttaactctccatgtcttcagcaatcatgtgggtctggggtgct |
42173286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 33 - 156
Target Start/End: Original strand, 337385 - 337508
Alignment:
| Q |
33 |
cgtagacggttagaacttcttcttgaggatgttgcatgtgactatgatcctttggattattatgaaacagctgagcagcttttggatcctctgctcctct |
132 |
Q |
| |
|
|||||||| || ||||| ||||| |||||| | ||||||| |||||||| ||||| ||||||||| | || ||||||||||| ||||||||||||| |
|
|
| T |
337385 |
cgtagacgattggaactgcttctagaggattgtccatgtgaacttgatccttctgattactatgaaacaaccgaacagcttttggaacctctgctcctct |
337484 |
T |
|
| Q |
133 |
gttatgaatctctggtactctttc |
156 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
337485 |
gttatgaatctatggtactctttc |
337508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University