View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_109 (Length: 309)
Name: NF1376_low_109
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_109 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 96 - 309
Target Start/End: Complemental strand, 29442907 - 29442693
Alignment:
| Q |
96 |
agaatgacaattaacttgttttaattcatgttgtctattaaatcatctgtgttcaattcacaactagactattgttagtttatgcagctggtcttgtttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442907 |
agaatgacaattaacttgttttaattcatgttgtctattaaattatatgtgttcaattcacaactagactattgttagtttatgcagctggtcttgtttc |
29442808 |
T |
|
| Q |
196 |
attggtgtaaccctcttttgttttaaatt-aattcaggttatgtgtgatgcatacactccagctggagaacccattcccaccaacaagagacacgcagct |
294 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442807 |
attggttacaccctcttttgttttaaattaaattcaggttatgtgtgatgcatacactccagctggagaacccattcccaccaacaagagacacgcagct |
29442708 |
T |
|
| Q |
295 |
gacgaggttttcagc |
309 |
Q |
| |
|
| | ||||||||||| |
|
|
| T |
29442707 |
gccaaggttttcagc |
29442693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 230 - 295
Target Start/End: Complemental strand, 33278124 - 33278059
Alignment:
| Q |
230 |
aggttatgtgtgatgcatacactccagctggagaacccattcccaccaacaagagacacgcagctg |
295 |
Q |
| |
|
|||||||||||||||| |||||| | |||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
33278124 |
aggttatgtgtgatgcctacactgctgctggagaacccattcccactaacaagagacacgctgctg |
33278059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University