View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_110 (Length: 308)
Name: NF1376_low_110
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_110 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 40834703 - 40834516
Alignment:
| Q |
1 |
ctgggttggaccctttattggtgctgccattgctgcaatctaccaccagtttgtgttgagagcacaagctgcaaaggctttgggttctttcaggagctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834703 |
ctgggttggaccctttattggtgctgccattgctgcaatctaccaccagtttgtgttgagagcacaagctgcaaaggctttgggttctttcaggagctct |
40834604 |
T |
 |
| Q |
101 |
tcaaatctgtaatggaatttcctgcaagttgccaagtaacataggcttgaataattaattgtatggttagacatatcctcatcattat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834603 |
tcaaatctgtaatggaatttcctgcaagttgccaagtaacataggcttgaataattaattgtatggttagacatatcctcatcattat |
40834516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 300
Target Start/End: Complemental strand, 40834450 - 40834418
Alignment:
| Q |
268 |
cttggtaaatttgaataaggatggatattgttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
40834450 |
cttggtaaatttgaataaggatggatgttgttg |
40834418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University