View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_115 (Length: 303)
Name: NF1376_low_115
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 44 - 286
Target Start/End: Original strand, 49294640 - 49294882
Alignment:
| Q |
44 |
cttagaatgtagagtaacagccaagggacaactcctcccccaacaaatgcagctctattcccatcactgggattcgaattcggaacatttgcttagtttt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294640 |
cttagaatgtagagtaacagccaagggacaactcctcccccaacaaatgcagctctattcccatcactgggattcgaattcggaacatttgcttagtttt |
49294739 |
T |
 |
| Q |
144 |
aattctctcaagtaaatggttttctgatgtattgtgatttttgaggttccttgtgttgagtgttgatttactgatgattttgcttaagctagtattgctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294740 |
aattctctcaagtaaatggttttctgatgtattgtgatttttgaggttccttgtgttgagtgttgatttactgatgattttgcttaagctagtattgctt |
49294839 |
T |
 |
| Q |
244 |
tgtttgcaatacaggggttcttatttgcctaatttgtctcctt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294840 |
tgtttgcaatacaggggttcttatttgcctaatttgtctcctt |
49294882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University