View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_117 (Length: 297)
Name: NF1376_low_117
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 72 - 152
Target Start/End: Original strand, 8315834 - 8315913
Alignment:
| Q |
72 |
tgaaccctgcggcgtcacagtctcaaattctgaacgagatatgaccgatcaggtattattgacttgtcaatcattctatag |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8315834 |
tgaaccctgcggcgtcacagtctcaaattctgaacgaga-atgaccgatcaggtattattgacttgtcaatcattctatag |
8315913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 237 - 293
Target Start/End: Original strand, 8315998 - 8316054
Alignment:
| Q |
237 |
accatcatagcatgtgttgattattatattagactatgattcagcgacaccagacac |
293 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8315998 |
accatcacagcatgtgttgattattatattagactatgattcaccgacaccagacac |
8316054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University