View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_125 (Length: 291)
Name: NF1376_low_125
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_125 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 39142335 - 39142601
Alignment:
| Q |
1 |
aaacatgaaacaaccttagcaacattttatgttttgtcaagaaaacagctgtcatggtgtttatgttttatgttttttcatttgttggaataaatgttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142335 |
aaacatgaaacaaccttagcaacattttatgttttgtcaagaaaacagctgtcatggtgtttatgttttatgttttttcatttgttggaataaatgttct |
39142434 |
T |
|
| Q |
101 |
ttatttgtagtttgaaatcatcatggtgatgnnnnnnnatttgttggaataaatgtatatgtatattactgcagtgatggattctgttttagtgattagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142435 |
ttatttgtagtttgaaatcatcatggtgatgtttttttatttgttggaataaatgtatatgtatattactgcagtgatggattctgttttagtgattagg |
39142534 |
T |
|
| Q |
201 |
tggttaaacatctattttcttggtgattatcatttgaatttgtttttgaaagttttgttatgtagta |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39142535 |
tggttaaacatctattttcttggtgattatcatttgaatttgtttttgaaagtttagttatgtagta |
39142601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University