View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_137 (Length: 269)
Name: NF1376_low_137
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_137 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 29 - 242
Target Start/End: Complemental strand, 31813094 - 31812881
Alignment:
| Q |
29 |
cacagacataacaccagaagtaatacacatgcgtctaactactcgcacacaacaacaaacccattcaccaaagatctaaactcacgaaggaaaaaggaca |
128 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31813094 |
cacaaacataacaccagaagtaatacacatgcgtctaactactcgcacacaacaacaaacccattcaccaaagatctaaactcacgaaggaaaaaggaca |
31812995 |
T |
 |
| Q |
129 |
ggcttcattttcgaagaaatgccacagtggcaacacgggagcctacggatccaccaaacatgaatgtcggatacgtgcggacatgactaacatattgaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31812994 |
ggcttcattttcgaagaaatgccacagtggcaacacgggagcctacggatccaccaaacatgaatgtcggatacgtgcggacatgactaacatattgaaa |
31812895 |
T |
 |
| Q |
229 |
taggggatctctgc |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31812894 |
taggggatctctgc |
31812881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University