View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_147 (Length: 257)
Name: NF1376_low_147
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_147 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 10972078 - 10971847
Alignment:
| Q |
1 |
cttcagtcacaacatcaattatacattgacatgnnnnnnn-atatgtacaatgtt--catccttatcgattaatcaaacacttgtggatacattgctaaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10972078 |
cttcagtcacaacatcaattatacattgacatgtttttttgatatgtacaatgttgacatccttttcgataaatcaaacacttgtggatacattgctaaa |
10971979 |
T |
|
| Q |
98 |
ctttatttataaaataaccatcaaaccaatattaagtaaacataaaacaaatattaagtaaaccgaaaagaaaaattgcaataacggttttcttcattct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10971978 |
ctttatttataaaataaccatcaaaccaatattaagtaaacataaaacaaatattaagtaaaccgaaaagaaaaattgcaataacggttttcttcattct |
10971879 |
T |
|
| Q |
198 |
ttccaataacggaatcttaatgacactatcct |
229 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
10971878 |
ttccaataagggaatcttaatgacactatcct |
10971847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University