View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1376_low_150 (Length: 253)

Name: NF1376_low_150
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1376_low_150
NF1376_low_150
[»] chr5 (1 HSPs)
chr5 (1-233)||(6297061-6297296)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 6297061 - 6297296
Alignment:
1 atgtaaattcctgttgcaatacgctttgaacttgtatgtgtgcgttattgttttagtat---ttgattgactggcagcttgtacttgcaggtggcaatag 97  Q
    ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||   ||||||||||||||||||||||||||||||||||||||    
6297061 atgtaaattcctgttgcaataagctttgaacttgtatgtgtgtgttattgttttagtatggtttgattgactggcagcttgtacttgcaggtggcaatag 6297160  T
98 attcagccacacctgttgacgatgctaggcccagtggaaattttatgatgaacaatagtatggaatcttttgggggatatggtggtccggtgcgaagtta 197  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6297161 attcagccacacctgttgacgatgctaggcccagcggaaattttatgatgaacaatagtatggaatcttttgggggatatggcggtccggtgcgaagtta 6297260  T
198 tgggaggatgtatggcggtttagactatgatgatgt 233  Q
    ||||||||||||||| ||||||||||||||||||||    
6297261 tgggaggatgtatggtggtttagactatgatgatgt 6297296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University