View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_158 (Length: 251)
Name: NF1376_low_158
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_158 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 107 - 239
Target Start/End: Complemental strand, 41918817 - 41918685
Alignment:
| Q |
107 |
ggttggcttcattttaatttgaacataaattaaaggtaattcaacttatggaagcttcctgatgctaataatagaatatgaagtcaattgagatgaaaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41918817 |
ggttggcttcattttaatttgaacatatattaaaggtaattcaaacaatggaagcttcctgatgctaataatagaatatgaagtcaattgagatgaaaat |
41918718 |
T |
|
| Q |
207 |
ataccttgaacagtatgcacttgatctaagaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41918717 |
ataccttgaacagtatgcacttgatctaagaat |
41918685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University