View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_161 (Length: 250)
Name: NF1376_low_161
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_161 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 37091746 - 37091615
Alignment:
| Q |
1 |
ctattaagatttggattattattaccgtaaagaaaaagatttggactattaatttctaataaactaatgagtttaatggtgatgttttgtatcataaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091746 |
ctattaagatttggattattattaccgtaaagaaaaagatttgaactattaatttctaataaactaatgagtttaatggtgatgttttgtatcataaaaa |
37091647 |
T |
|
| Q |
101 |
ttgtaagtatcttaat--gatatgacgttatg |
130 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
37091646 |
ttgtaagtatcttaataagatatgacgttatg |
37091615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University