View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_163 (Length: 248)
Name: NF1376_low_163
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_163 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 7959319 - 7959549
Alignment:
| Q |
1 |
attaattagtagacaaagtatcaaacacttactgggatagtgattctgacgacattgtatttttagagacaaatcttcctcctttgtgattatattctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7959319 |
attaattagtagacaaagtatcaaacacttactaggatagtgattctgat---attgtatttttagagacaaatcttcctcctttgtgattatattctca |
7959415 |
T |
 |
| Q |
101 |
tagtcaacatactaacatgcatcttggtaatttatatattttatatttggttttcttttgtgtgatcactttctatgtgtattatattaatttaaaacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7959416 |
tagtcaacatactaacatgcatcttggtaatttatatattttatatttggttttcttttgtgtgatcattttctatgtgtattatattaatttaaaacgt |
7959515 |
T |
 |
| Q |
201 |
ttattgcatttttcttcttgtttaatgtcctaga |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
7959516 |
ttattgcatttttcttcttgttttatgtcctaga |
7959549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University