View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_182 (Length: 219)
Name: NF1376_low_182
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_182 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 17687713 - 17687573
Alignment:
| Q |
1 |
cactaattaaacaaacattacacttgaacaattgagagccttgcttgtttctcataccagcaattgtttatattcgtgaaacatctagtttgaagatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17687713 |
cactaattaaacaaacattacacttgaacaattgagagccttg-ttgtttctcataccggcaattgtttatattcgtgaaacatccagtttgaagatcca |
17687615 |
T |
 |
| Q |
101 |
ccaccaaaatataaatcccaaagcctagaatagtagaataat |
142 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17687614 |
ccaccaaaatataaaccccaaagcctagaatagtagaataat |
17687573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University