View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_188 (Length: 207)
Name: NF1376_low_188
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_188 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 54 - 207
Target Start/End: Complemental strand, 42634799 - 42634646
Alignment:
| Q |
54 |
ttcatgtataattcatagtcgggaagagcatgttgtataatggggattttagcattttatattagttatggaagatgttgttggagttttgtagatggtt |
153 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42634799 |
ttcatgtataattctttgtcgggaagagcatgttgtataatggggattttagcattttatattagttatggaagatgttgttggagttttgtagatggtt |
42634700 |
T |
 |
| Q |
154 |
accacaatattaaggacaacttaatcagattcaaggaatgtgattacggcaatt |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42634699 |
accacaatattaaggagaacttaatcagattcatggaatgtgattacggcaatt |
42634646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 42634860 - 42634828
Alignment:
| Q |
1 |
attacacacagaaatctctatacaacacagaaa |
33 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
42634860 |
attacacacagaaatctctatacaacgcagaaa |
42634828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 178 - 207
Target Start/End: Complemental strand, 25518369 - 25518340
Alignment:
| Q |
178 |
tcagattcaaggaatgtgattacggcaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25518369 |
tcagattcaaggaatgtgattacggcaatt |
25518340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University