View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_38 (Length: 465)
Name: NF1376_low_38
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 29 - 409
Target Start/End: Original strand, 38120594 - 38120974
Alignment:
| Q |
29 |
agatgatgcaacgatggtgtggtgaagtgatgaagcagaataactatgttaattaataccaaagttgtgctaatgatactcatgactatgcaatgcaact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120594 |
agatgatgcaacgatggtgtggtgaagtgatgaagcagaataactatgttaattaataccaaagttgtgctaatgatactcatgactatgcaatgcaact |
38120693 |
T |
 |
| Q |
129 |
attattnnnnnnnctaaacgttttgtaaccactgcaagaaaagtaaacatttgaagaggcaaatgtgatattattattgtgtcttatttatactaaagga |
228 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120694 |
attattaagaaaactaaacgttttgtaaccactgcaagaaaagtaaacatttgaagaggcaaatgtgatattattattgtgtcttatttatactaaagga |
38120793 |
T |
 |
| Q |
229 |
gttggtttcggttcagcttcaacttctttgttaagttaccgttttgcaattgaaggttagccaccaatcatattcatcatgatatcacacttactataaa |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120794 |
gttggtttcggttcagcttcaacttctttgttaagttaccgttttgcaattgaaggttagccaccaatcatattcatcatgatatcacacttactataaa |
38120893 |
T |
 |
| Q |
329 |
tagaatcatgctatctttctctttaaccaaacactttaccctcttcattatctttggttacttcacactgtttttcttttc |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120894 |
tagaatcatgctatctttctctttaaccaaacactttaccctcttcattatctttggttacttcacactgtttttcttttc |
38120974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University