View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_49 (Length: 417)
Name: NF1376_low_49
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 29 - 404
Target Start/End: Original strand, 38120594 - 38120969
Alignment:
| Q |
29 |
agatgatgcaacgatggtgtggtgaagtgatgaagcagaataactatgttaattaataccaaagttgtgctaatgatactcatgactatgcaatgcaact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120594 |
agatgatgcaacgatggtgtggtgaagtgatgaagcagaataactatgttaattaataccaaagttgtgctaatgatactcatgactatgcaatgcaact |
38120693 |
T |
|
| Q |
129 |
attattnnnnnnnctaaacgttttgtaaccactgcaagaaaagtaaacatttgaagaggcaaatgtgatattattattgtgtcttatttatactaaagga |
228 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120694 |
attattaagaaaactaaacgttttgtaaccactgcaagaaaagtaaacatttgaagaggcaaatgtgatattattattgtgtcttatttatactaaagga |
38120793 |
T |
|
| Q |
229 |
gttggtttcggttcagcttcaacttctttgttaagttaccgttttgcaattgaaggttagccaccaatcatattcatcatgatatcacacttactataaa |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120794 |
gttggtttcggttcagcttcaacttctttgttaagttaccgttttgcaattgaaggttagccaccaatcatattcatcatgatatcacacttactataaa |
38120893 |
T |
|
| Q |
329 |
tagaatcatgctatctttctctttaaccaaacactttaccctcttcattatctttggttacttcacactgtttttc |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120894 |
tagaatcatgctatctttctctttaaccaaacactttaccctcttcattatctttggttacttcacactgtttttc |
38120969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University