View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_79 (Length: 353)
Name: NF1376_low_79
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 39142353 - 39142601
Alignment:
| Q |
1 |
gcaacattttatgttttgtcaagaaaacagctgtcatggtgtttatgttttatgttttttcatttgttggaataaatgttctttatttgtagtttgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142353 |
gcaacattttatgttttgtcaagaaaacagctgtcatggtgtttatgttttatgttttttcatttgttggaataaatgttctttatttgtagtttgaaat |
39142452 |
T |
 |
| Q |
101 |
catcatggtgatgnnnnnnnatttgttggaataaatgtatatgtatattactgcagtgatggattctgttttagtgattaggtggttaaacatctatttt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39142453 |
catcatggtgatgtttttttatttgttggaataaatgtatatgtatattactgcagtgatggattctgttttagtgattaggtggttaaacatctatttt |
39142552 |
T |
 |
| Q |
201 |
cttggtgattatcatttgaatttgtttttgaaagttttgttatgtagta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39142553 |
cttggtgattatcatttgaatttgtttttgaaagtttagttatgtagta |
39142601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University