View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_85 (Length: 338)
Name: NF1376_low_85
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 78 - 282
Target Start/End: Original strand, 39745773 - 39745977
Alignment:
| Q |
78 |
ataatatcatcccaattaatttacagggctgtatagatacagagttggtgatgtacttcaagtggttgctttccacaacaaagccccacaatttcgattc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39745773 |
ataatatcatcccaattaatttacagggctgtatagatacagagttggtgatgtacttcaagtggttgctttccacaacaaagccccacaatttcgattc |
39745872 |
T |
 |
| Q |
178 |
atatgtagaagaaacgtagtaataagcattgacagtgaaaagacaaatgaagaggatttacatagaagtgcgacaatggccaaaaagttattagaaccct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
39745873 |
atatgtagaagaaacgtagtaataagcattgacagtgaaaagacaaatgaagaggatttacatagaagtgtgacaatgtccaaaaagttattagaaccct |
39745972 |
T |
 |
| Q |
278 |
atgat |
282 |
Q |
| |
|
||||| |
|
|
| T |
39745973 |
atgat |
39745977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University