View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1376_low_88 (Length: 336)
Name: NF1376_low_88
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1376_low_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 17 - 307
Target Start/End: Original strand, 37019925 - 37020215
Alignment:
| Q |
17 |
tcccatgaccttgtagtgtgcaatttatattccttgctcaagaaaacagaaactacatttgaattatctgcaacaacatagaaacatatataaatagtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37019925 |
tcccatgaccttgtagtgtgcaatttatattccttgctcaagaaaacagaaactacatttgaattatctgcaccaacatagaaacatatataaatagtgt |
37020024 |
T |
|
| Q |
117 |
caatttgtgtcttaaaaaatactcaacaaatccatggtnnnnnnngtaattattgcttacttgcaatctttgatgcctcttcatcttcaagcagtgcagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37020025 |
caatttgtgtcttaaaaaatactcaacaaatccatggtaaaaaaagtaattattgcttacttgcaatctttgatgcctcttcatcttcaagcagtgcagc |
37020124 |
T |
|
| Q |
217 |
aaatccatttatatgcttattgtaagagtacatcactgtttcctttgccttctcatggctgttataaaaacacaactattttagtactact |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
37020125 |
aaatccatttatatgcttattgtaagagtacatcactgtttcctttgccttctcatggctgttacaaaaacacaactattttagcactact |
37020215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 276
Target Start/End: Complemental strand, 24265663 - 24265559
Alignment:
| Q |
172 |
cttacttgcaatctttgatgcctcttcatcttcaagcagtgcagcaaatccatttatatgcttattgtaagagtacatcactgtttcctttgccttctca |
271 |
Q |
| |
|
|||||||||||| |||| ||| ||||| ||||||| | |||||||| ||||| || || |||||||| ||||| | | || |||||| ||||||||| |
|
|
| T |
24265663 |
cttacttgcaatttttgctgcttcttctacttcaagtacagcagcaaaaccattgatgtgtttattgtatgagtaaaatattgcttccttagccttctca |
24265564 |
T |
|
| Q |
272 |
tggct |
276 |
Q |
| |
|
||||| |
|
|
| T |
24265563 |
tggct |
24265559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University