View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1376_low_94 (Length: 330)

Name: NF1376_low_94
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1376_low_94
NF1376_low_94
[»] chr2 (1 HSPs)
chr2 (79-200)||(19475341-19475462)
[»] chr7 (1 HSPs)
chr7 (261-330)||(41578850-41578919)
[»] chr4 (1 HSPs)
chr4 (110-196)||(51547480-51547566)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 79 - 200
Target Start/End: Original strand, 19475341 - 19475462
Alignment:
79 aataccaagttataaaactaacattgtgatgcttggtgatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttc 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19475341 aataccaagttataaaactaacattgtgatgcttggtgatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttc 19475440  T
179 agatctgcaactttaggtgaag 200  Q
    ||||||||||||||||||||||    
19475441 agatctgcaactttaggtgaag 19475462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 261 - 330
Target Start/End: Complemental strand, 41578919 - 41578850
Alignment:
261 aataagtggccataatcacgactcataatcatggcaaataacagtcaccattggtgatactgaaaattcc 330  Q
    ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
41578919 aataagtggccataatcacgactcaaaatcatggcaaataacagtcgccattggtgatactgaaaattcc 41578850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 196
Target Start/End: Original strand, 51547480 - 51547566
Alignment:
110 cttggtgatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttcagatctgcaactttaggt 196  Q
    |||||||||||||| |||   |||||||| ||||| || ||||||| |||||||||||||||||| |||||||||||||||||||||    
51547480 cttggtgatggaagggatcaaactgtcattactggcaatagaagtgatgttgatggatggaccaccttcagatctgcaactttaggt 51547566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University