View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1376_low_98 (Length: 323)

Name: NF1376_low_98
Description: NF1376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1376_low_98
NF1376_low_98
[»] chr3 (1 HSPs)
chr3 (123-323)||(17687481-17687680)


Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 123 - 323
Target Start/End: Original strand, 17687481 - 17687680
Alignment:
123 gtttcattggatcttattttggggatagttgctgaatttgaaatttaactatattttggtctttttgttttgcaaatttctaatgttattatattattct 222  Q
    |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17687481 gtttcattggatcttattttggggattgttgctgaatttgaaattgaactatatttttgtctttttgttttgcaaatttctaatgttattatattattct 17687580  T
223 actattctaggctttgggatttatattttggtggtggatcttcaaactagatgtttcacgaatataaacaattgctggtatgagaaacaagcaaggctct 322  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||    
17687581 actattctaggctttggggtttatattttggtggtggatcttcaaactggatgtttcacgaatataaacaattgccggtatgagaaacaa-caaggctct 17687679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University