View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377-INSERTION-1 (Length: 116)
Name: NF1377-INSERTION-1
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 27888547 - 27888440
Alignment:
| Q |
7 |
aggttgggggttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagcaagtagttgagtgttgctctttgttggacaatattc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27888547 |
aggttgggggttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagtaagtagttgagtgttgctctttgctggacaatattc |
27888448 |
T |
 |
| Q |
107 |
ttttgcag |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
27888447 |
ttttgcag |
27888440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University