View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1377-INSERTION-1 (Length: 116)

Name: NF1377-INSERTION-1
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1377-INSERTION-1
NF1377-INSERTION-1
[»] chr4 (1 HSPs)
chr4 (7-114)||(27888440-27888547)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 27888547 - 27888440
Alignment:
7 aggttgggggttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagcaagtagttgagtgttgctctttgttggacaatattc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||    
27888547 aggttgggggttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagtaagtagttgagtgttgctctttgctggacaatattc 27888448  T
107 ttttgcag 114  Q
    ||||||||    
27888447 ttttgcag 27888440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University