View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377-INSERTION-2 (Length: 122)
Name: NF1377-INSERTION-2
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377-INSERTION-2 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 47170798 - 47170912
Alignment:
| Q |
8 |
cttttttattccaatttttgatgcataaatatatttgtttttaatcaaaagaaatttggtcatgttttttctagggcgtggagactgaggacaatgaata |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170798 |
cttttttattcaaatttttgatgcataaatatatttgtttttaatcaaaagaaatttggtcatgttttttctagggcgtggagactgaggacaatgaata |
47170897 |
T |
 |
| Q |
108 |
tttcatcactcctga |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47170898 |
tttcatcactcctga |
47170912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 70 - 122
Target Start/End: Complemental strand, 42163378 - 42163326
Alignment:
| Q |
70 |
tgttttttctagggcgtggagactgaggacaatgaatatttcatcactcctga |
122 |
Q |
| |
|
||||||| |||||| ||||| | |||||| |||||||| |||||||||||||| |
|
|
| T |
42163378 |
tgtttttgctagggtgtggatattgaggataatgaatacttcatcactcctga |
42163326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University