View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377-INSERTION-3 (Length: 437)
Name: NF1377-INSERTION-3
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377-INSERTION-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 292
Target Start/End: Original strand, 1684966 - 1685228
Alignment:
| Q |
30 |
ttatttgagggtctattttttatcgtcaagtgttgtgcatcattctttctttgtatctgtttcatgcaaagcaaactcgtaacattcatctactttttat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1684966 |
ttatttgagggtctattttttatcgtcaagtgctgtgcatcattctttctttgtatctgtttcatgcaaagcaaaatcgtaacattcatctactttttat |
1685065 |
T |
|
| Q |
130 |
aaacttaaaaaatcttgatacccttttgtgataatcgattggtatcgtaattaaaggtgcaaacaaaccctgttgtttatgcataactagtgcaaaaaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1685066 |
aaacttaaaaaatcttgatacccttttgtgataatcgattggtatcgtaattaaaggtgcaaacaaaccctgttgtttatgcataactagtgcaaaaaat |
1685165 |
T |
|
| Q |
230 |
ctgaannnnnnnnnnnnagtcatagtttttgggtgccgcatagggtttgttactctcctccat |
292 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1685166 |
ctgaattttttatttttagtcatagtttttgggtgccgcatagggtttgttactctcctccat |
1685228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 110 - 173
Target Start/End: Original strand, 44923296 - 44923359
Alignment:
| Q |
110 |
aacattcatctactttttataaacttaaaaaatcttgatacccttttgtgataatcgattggta |
173 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| |||||||||||||| | |||||||||||| |
|
|
| T |
44923296 |
aacattcatctactttctataaacttcaaaaatattgatacccttttgctagaatcgattggta |
44923359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University