View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377-INSERTION-5 (Length: 160)
Name: NF1377-INSERTION-5
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377-INSERTION-5 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 3e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 28604291 - 28604443
Alignment:
| Q |
8 |
catctagggagtaattcatccaaggacttgggtttcttaacatctttgacaaattgcacaaatttacaagtgttggatttaaatctaaacaactttggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28604291 |
catctagggagtaattcatccaaggacttggatttcttaacatctttgacaaattgcacaaatttacaagtgttggatttaaatctaaacaactttggtg |
28604390 |
T |
|
| Q |
108 |
gttatttaccaaattctgtagctaacttttcacgtcaactgaatcagttttat |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28604391 |
gttatttaccaaactctgtagctaacttttcacgtcaactgagtcagttttat |
28604443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 19 - 157
Target Start/End: Complemental strand, 27725586 - 27725448
Alignment:
| Q |
19 |
taattcatccaaggacttgggtttcttaacatctttgacaaattgcacaaatttacaagtgttggatttaaatctaaacaactttggtggttatttacca |
118 |
Q |
| |
|
||||||||| | ||||||| |||||| |||||||||||||| |||||||| |||| ||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
27725586 |
taattcatctcatgacttggatttcttgacatctttgacaaactgcacaaacttacgagtgttgcatttaaatctgaacaactttggtggttctttacct |
27725487 |
T |
|
| Q |
119 |
aattctgtagctaacttttcacgtcaactgaatcagttt |
157 |
Q |
| |
|
|| |||||||| ||||| || ||||||| || |||||| |
|
|
| T |
27725486 |
aaatctgtagccaacttatctagtcaactaaaccagttt |
27725448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University