View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13770_high_2 (Length: 524)
Name: NF13770_high_2
Description: NF13770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13770_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 25 - 293
Target Start/End: Complemental strand, 42932395 - 42932127
Alignment:
| Q |
25 |
atcacatttgcagaaacagttccaaacctgattaaggatgaagcaaccaactttagttattgtgaaaatgataacaggataagcatcacgacgcaattag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932395 |
atcacatttgcagaaacagttccaaacctgattaaggatgaagcaaccgactttagttattgttaaaatgataacaggataagcatcacgacgcaattag |
42932296 |
T |
|
| Q |
125 |
aaacatgatgatttaaaacttacgaacaatctgcaggataaccattgatttctctgcaaccccctttagggcatagatacctaaaatcattcaatggata |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42932295 |
aaacatgatgatttaaaacttacgaacaatctgcaggataaccattgatttctctgcaaccccctttagggcaaagatacctaaaatcattcaatggata |
42932196 |
T |
|
| Q |
225 |
ttgatattagttgagaaaaacacctactttatgcatcacatgaaaagtttattaggcaaggtacttaca |
293 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932195 |
ttgatattagttgaggaaaacacctactttatgcatcacatgaaaagtttattaggcaaggtacttaca |
42932127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 292 - 484
Target Start/End: Complemental strand, 42931156 - 42930942
Alignment:
| Q |
292 |
caccgcgcaccacctcactccgccgtcatctgtcgccggatcattgggtgcgctggccctcccattt---------------------ttcgatattgga |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
42931156 |
caccgcgcaccacctcactccgccgtcatctgtcgccggatcattgggtgcgttggccctcccatttccatggcctcccaccccattttccgatattgga |
42931057 |
T |
|
| Q |
371 |
gctgcagcttcgggagaccc-accatgccactcctccatcaccactggcgacgggggatcagactcaccgaaaataggcccatcattgccactaccttct |
469 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42931056 |
gctgcagcttcgggagaccccatcatggcactcctccatcaccactggcgacgggggatcagacacaccggaaataggcccatcattgccactaccttct |
42930957 |
T |
|
| Q |
470 |
gcatctactggagga |
484 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
42930956 |
gcatctactagagga |
42930942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University